filamentous bacteriophage Complex DNA nanostructures have been developed as structural components for the construction of nanoscale objects. Recent advances have enabled self-assembly of organized DNA
This is what the Corona covid 19 injection PATENTS are explaining as part of the ingredients, biological technology as a delivery system
Complex DNA nanostructures have been developed as structural components for the construction of nanoscale objects. Recent advances have enabled self-assembly of organized DNA nanolattices and their use in patterning functional bio-macromolecules and other nanomaterials. Adapter molecules that bind specifically to both DNA lattices and nanomaterials...
Download full-text
Contexts in source publication
Context 1
... display, peptides or protein domains are cloned as fusions to the coat proteins of M13 phage. M13 is a filamentous bacteriophage composed of single stranded DNA encapsulated in a shell of approximately 2700 copies of the major coat protein pVIII, and capped with about 5 copies of each minor coat protein (pIII, pVI, pVII, and pIX) on the ends (Fig. 1B). 22 The genes encoding the scFv can be cloned into the phage genome and expressed as fusions to the pIII proteins on the phage coat. 23 Specific scFv clones and their associated phage can be selected from a large pool of variants by affinity purification using an ap- propriate binding and collection strategy. While weakly interacting ...
Context 2
... experiments described herein utilized a DNA hairpin struc- ture with 22 nucleotides (GGATCCTGGTGGAGCAGGATCC), which is predicted to form a stem with 8 base-pairs and a loop region containing 6 nucleotides (Fig. 1A). For phage selection, the DNA was biotinylated at the 5 end, immobilized on streptavidin magnetic beads and then incubated with several scFv libraries in which each recombinant antibody fragment is displayed as a capsid protein fusion on the surface of a rescued phage particle. Phage particles displaying scFvs specific for the target ...
Context 3
... scFv displays and 2 × 2 array templated scFv binding, 1 ll of annealed DNA sample (1 lM) was incubated with 1 ll purified scFv (10 lM) in 20 ll TAE/Mg 2+ buffer. For multilayer DNA-scFv complexes with scFv molecules sandwiched in between, the ratio between the DNA complex and purified scFv was adjusted to larger than 1 : 1. Shown specifically in Fig. 5, 15 ll of annealed DNA sample (1 lM) was incubated with 1 ll purified scFv (10 lM) in a total of 20 ll 1 x TAE/Mg 2+ buffer. The solution was incubated overnight at 4 • C before AFM imaging. Org. Biomol. Chem., 2006, 4, 3420-3426 | 3425 buffer was then placed onto the mica. DNA interacts with the mica surface by nonspecific ionic charge ..